Home > Mutants (Isolated) > tm1156

Mutants (Isolated)

Allele Name		tm1156
Allele Type		Normal
Sequence Name		Y66A7A.6
Gene Name		gly-8
Worm Base	Allele Name	tm1156
	Gene Name	gly-8
	Sequence	Y66A7A.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[Y66A7AR] 15318/15319-[Y66A7AR] 16256/16257 (938 bp deletion)
Chromosome		III
Putative gene structure		join(14766..14872, 15159..15237, 15293..15396, 15919..16171, 16249..16382, 16429..16587, 16635..16752, 17368..17520, 17566..17724)
Map position		11.36
Balancer
Map position of balancer
Sequence of primers		ExtRev:CGATATGTCGGGCGCAACCT,IntRev:CAACCTCGCCTCCACATAGT,ExtFwd:TACAGAATGCGACGCCACGT,IntFwd:CGCCACGTCGTCCTATCGAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705  [ PubMed ID = 38239833 ] [ RRC reference ] Tsai HY, Cheng HT, Tsai YT. Biogenesis of C. elegans spermatogenesis small RNAs is initiated by a zc3h12a-like ribonuclease. Sci Adv 2022 8(32) eabm0699  [ PubMed ID = 35947655 ] [ RRC reference ] Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC. Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy. PLoS Genet 2019 15(12) e1008526  [ PubMed ID = 31834878 ] [ RRC reference ]