Mutants (Isolated)

tm1155

Allele Nametm1155
Sequence NameT22B3.2
CGC Namealg-3
Worm BaseAllele Name tm1155
CGC Name alg-3
Sequence T22B3.2
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site7953/7954-8282/8283 (329 bp deletion)
ChromosomeIV
Putative gene structurejoin(7958..8012, 8296..8453, 8503..8675, 8721..9605, 9658..9874, 9921..10251, Z68750.1:110..286, Z68750.1:337..599, Z68750.1:644..768, Z68750.1:813..1310, Z68750.1:1357..1481, Z68750.1:1529..1620)
Map position5.22
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCAATGGTTAGAAGTCGCA,IntFwd:GAGGACAACACGCTATGGAA,ExtRev:CGTACTTCTCGGAGAAGTAG,IntRev:CCGAGCACACAACTTGTCGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Campbell AC, Updike DL.
CSR-1 and P granules suppress sperm-specific transcription in the C. elegans germline.
Development 2015 142(10) 1745-55 
[ PubMed ID = 25968310 ] [ RRC reference ]

Conine CC, Moresco JJ, Gu W, Shirayama M, Conte D Jr, Yates JR 3rd, Mello CC.
Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans.
Cell 2013 155(7) 1532-44 
[ PubMed ID = 24360276 ] [ RRC reference ]

Han T, Manoharan AP, Harkins TT, Bouffard P, Fitzpatrick C, Chu DS, Thierry-Mieg D, Thierry-Mieg J, Kim JK.
26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2009 106(44) 18674-9 
[ PubMed ID = 19846761 ] [ RRC reference ]

Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3588-93 
[ PubMed ID = 20133686 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev. Cell 2015 34(4) 457-65 
[ PubMed ID = 26279487 ] [ RRC reference ]

Almeida MV, Dietz S, Redl S, Karaulanov E, Hildebrandt A, Renz C, Ulrich HD, K├Ânig J, Butter F, Ketting RF.
GTSF-1 is required for formation of a functional RNA-dependent RNA Polymerase complex in Caenorhabditis elegans.
EMBO J. 2018 37(12)  
[ PubMed ID = 29769402 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]