Mutants (Isolated)

tm1153

Allele Nametm1153
Sequence NameF45E6.2
CGC Nameatf-6
Worm BaseAllele Name tm1153
CGC Name atf-6
Sequence F45E6.2
Phenotypehomozygous viable
Mutation site11879/11880-12522/12523 (643 bp deletion)
ChromosomeX
Putative gene structurejoin(10548..10640, 10697..10888, 11181..11456, 11505..11675, 11726..11902, 11951..12190, 12237..12322, 12372..12602, 12835..13051, 13786..13872)
Map position7.11
Balancer
Map position of balancer
Sequence of primersIntRev:GTGCCCATTCGTGTCATTAT,ExtRev:ACGTCGGTAGTGTGCCCATT,IntFwd:CCGCCGCAATTTGACCAGCT,ExtFwd:TCCTTAATCGTCTTGCCCTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mao XR, Crowder CM.
Protein misfolding induces hypoxic preconditioning via a subset of the unfolded protein response machinery.
Mol. Cell. Biol. 2010 30(21) 5033-42 
[ PubMed ID = 20733002 ] [ RRC reference ]

Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]