Mutants (Isolated)

tm1153

Allele Nametm1153
Sequence NameF45E6.2
CGC Nameatf-6
Worm BaseAllele Name tm1153
CGC Name atf-6
Sequence F45E6.2
Phenotypehomozygous viable
Mutation site11879/11880-12522/12523 (643 bp deletion)
ChromosomeX
Putative gene structurejoin(10548..10640, 10697..10888, 11181..11456, 11505..11675, 11726..11902, 11951..12190, 12237..12322, 12372..12602, 12835..13051, 13786..13872)
Map position7.11
Balancer
Map position of balancer
Sequence of primersIntRev:GTGCCCATTCGTGTCATTAT,ExtRev:ACGTCGGTAGTGTGCCCATT,IntFwd:CCGCCGCAATTTGACCAGCT,ExtFwd:TCCTTAATCGTCTTGCCCTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Waldherr SM, Strovas TJ, Vadset TA, Liachko NF, Kraemer BC.
Constitutive XBP-1s-mediated activation of the endoplasmic reticulum unfolded protein response protects against pathological tau.
Nat Commun 2019 10(1) 4443 
[ PubMed ID = 31570707 ] [ RRC reference ]

Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc Natl Acad Sci U S A 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]

Mao XR, Crowder CM.
Protein misfolding induces hypoxic preconditioning via a subset of the unfolded protein response machinery.
Mol Cell Biol 2010 30(21) 5033-42 
[ PubMed ID = 20733002 ] [ RRC reference ]