Mutants (Isolated)

tm1145

Allele Nametm1145
Sequence NameC36A4.8
CGC Namebrc-1
Worm BaseAllele Name tm1145
CGC Name brc-1
Sequence C36A4.8
Phenotypehomozygous viable. Dr. A. Dernburg: nonHim, normal meiosis. Dr. S. Boulton: EMBO J, 24, 4345-4355 (2005), Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006)
Mutation site33302/33303-33971/33972 (669 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24651..24899, 25595..25768, 29731..29849, 32650..33031, 33094..33167, 33217..33445, 33902..34247, 34301..34371))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AATATAGGCACCGGCGGGGA,ExtRev:CTCCGTAGCTTGAAGTCTCA,IntFwd:TGTCGCATCGTCGGCATTAA,ExtFwd:TTTCGGTGGCGCCACATGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakai Y, Hanafusa H, Shimizu T, Pastuhov SI, Hisamoto N, Matsumoto K.
BRCA1-BARD1 Regulates Axon Regeneration in Concert with the Gqα-DAG Signaling Network.
J Neurosci 2021 41(13) 2842-2853 
[ PubMed ID = 33593852 ] [ RRC reference ]

Padeken J, Zeller P, Towbin B, Katic I, Kalck V, Methot SP, Gasser SM.
Synergistic lethality between BRCA1 and H3K9me2 loss reflects satellite derepression.
Genes Dev 2019 33(7-8) 436-451 
[ PubMed ID = 30804228 ] [ RRC reference ]

Fang EF, Hou Y, Lautrup S, Jensen MB, Yang B, SenGupta T, Caponio D, Khezri R, Demarest TG, Aman Y, Figueroa D, Morevati M, Lee HJ, Kato H, Kassahun H, Lee JH, Filippelli D, Okur MN, Mangerich A, Croteau DL, Maezawa Y, Lyssiotis CA, Tao J, Yokote K, Rusten TE, Mattson MP, Jasper H, Nilsen H, Bohr VA.
NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
Nat Commun 2019 10(1) 5284 
[ PubMed ID = 31754102 ] [ RRC reference ]

Chou WY, Lin YC, Lee YH.
Short-term starvation stress at young adult stages enhances meiotic activity of germ cells to maintain spermatogenesis in aged male Caenorhabditis elegans.
Aging Cell 2019 18(3) e12930 
[ PubMed ID = 30816005 ] [ RRC reference ]

Torgovnick A, Schiavi A, Shaik A, Kassahun H, Maglioni S, Rea SL, Johnson TE, Reinhardt HC, Honnen S, Schumacher B, Nilsen H, Ventura N.
BRCA1 and BARD1 mediate apoptotic resistance but not longevity upon mitochondrial stress in Caenorhabditis elegans.
EMBO Rep 2018 19(12)  
[ PubMed ID = 30366941 ] [ RRC reference ]

Li Q, Saito TT, Martinez-Garcia M, Deshong AJ, Nadarajan S, Lawrence KS, Checchi PM, Colaiacovo MP, Engebrecht J.
The tumor suppressor BRCA1-BARD1 complex localizes to the synaptonemal complex and regulates recombination under meiotic dysfunction in Caenorhabditis elegans.
PLoS Genet 2018 14(11) e1007701 
[ PubMed ID = 30383767 ] [ RRC reference ]

Park S, Choi S, Ahn B.
DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay.
Mol Cells 2016 39(3) 204-10 
[ PubMed ID = 26903030 ] [ RRC reference ]

Hyun M, Choi S, Stevnsner T, Ahn B.
The Caenorhabditis elegans Werner syndrome protein participates in DNA damage checkpoint and DNA repair in response to CPT-induced double-strand breaks.
Cell Signal 2016 28(3) 214-223 
[ PubMed ID = 26691982 ] [ RRC reference ]

Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Hong Y, Sonneville R, Agostinho A, Meier B, Wang B, Blow JJ, Gartner A.
The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.
PLoS Genet 2016 12(3) e1005872 
[ PubMed ID = 27010650 ] [ RRC reference ]

Koon JC, Kubiseski TJ.
Developmental arrest of Caenorhabditis elegans BRAP-2 mutant exposed to oxidative stress is dependent on BRC-1.
J Biol Chem 2010 285(18) 13437-43 
[ PubMed ID = 20207739 ] [ RRC reference ]

Roerink SF, Koole W, Stapel LC, Romeijn RJ, Tijsterman M.
A broad requirement for TLS polymerases η and κ, and interacting sumoylation and nuclear pore proteins, in lesion bypass during C. elegans embryogenesis.
PLoS Genet 2012 8(6) e1002800 
[ PubMed ID = 22761594 ] [ RRC reference ]

Ryu JS, Kang SJ, Koo HS.
The 53BP1 homolog in C. elegans influences DNA repair and promotes apoptosis in response to ionizing radiation.
PLoS One 2013 8(5) e64028 
[ PubMed ID = 23667696 ] [ RRC reference ]

D'Amora DR, Hu Q, Pizzardi M, Kubiseski TJ.
BRAP-2 promotes DNA damage induced germline apoptosis in C. elegans through the regulation of SKN-1 and AKT-1.
Cell Death Differ 2018 25(7) 1276-1288 
[ PubMed ID = 29358669 ] [ RRC reference ]

Butuči M, Williams AB, Wong MM, Kramer B, Michael WM.
Zygotic Genome Activation Triggers Chromosome Damage and Checkpoint Signaling in C. elegans Primordial Germ Cells.
Dev Cell 2015 34(1) 85-95 
[ PubMed ID = 26073019 ] [ RRC reference ]

Germoglio M, Valenti A, Gallo I, Forenza C, Santonicola P, Silva N, Adamo A.
In vivo analysis of FANCD2 recruitment at meiotic DNA breaks in Caenorhabditis elegans.
Sci Rep 2020 10(1) 103 
[ PubMed ID = 31919410 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Li X, Boog H, Lehmer MK, Rosenberg SC, Barroso C, Martinez-Perez E, Corbett KD, Carlton PM.
Phosphoregulation of HORMA domain protein HIM-3 promotes asymmetric synaptonemal complex disassembly in meiotic prophase in Caenorhabditis elegans.
PLoS Genet 2020 16(11) e1008968 
[ PubMed ID = 33175901 ] [ RRC reference ]

Couteau F, Zetka M.
DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly.
Dev Cell 2011 20(3) 353-63 
[ PubMed ID = 21397846 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]

Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79 
[ PubMed ID = 22665589 ] [ RRC reference ]