Mutants (Isolated)

tm1145

Allele Nametm1145
Sequence NameC36A4.8
CGC Namebrc-1
Worm BaseAllele Name tm1145
CGC Name brc-1
Sequence C36A4.8
Phenotypehomozygous viable. Dr. A. Dernburg: nonHim, normal meiosis. Dr. S. Boulton: EMBO J, 24, 4345-4355 (2005), Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006)
Mutation site33302/33303-33971/33972 (669 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24651..24899, 25595..25768, 29731..29849, 32650..33031, 33094..33167, 33217..33445, 33902..34247, 34301..34371))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AATATAGGCACCGGCGGGGA,ExtRev:CTCCGTAGCTTGAAGTCTCA,IntFwd:TGTCGCATCGTCGGCATTAA,ExtFwd:TTTCGGTGGCGCCACATGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boulton SJ.
BRCA1-mediated ubiquitylation.
Cell Cycle 2006 5(14) 1481-6 
[ PubMed ID = 16861894 ] [ RRC reference ]

Adamo A, Montemauri P, Silva N, Ward JD, Boulton SJ, La Volpe A.
BRC-1 acts in the inter-sister pathway of meiotic double-strand break repair.
EMBO Rep. 2008 9(3) 287-92 
[ PubMed ID = 18219312 ] [ RRC reference ]

Butuči M, Williams AB, Wong MM, Kramer B, Michael WM.
Zygotic Genome Activation Triggers Chromosome Damage and Checkpoint Signaling in C. elegans Primordial Germ Cells.
Dev. Cell 2015 34(1) 85-95 
[ PubMed ID = 26073019 ] [ RRC reference ]

Ryu JS, Kang SJ, Koo HS.
The 53BP1 homolog in C. elegans influences DNA repair and promotes apoptosis in response to ionizing radiation.
PLoS ONE 2013 8(5) e64028 
[ PubMed ID = 23667696 ] [ RRC reference ]

Roerink SF, Koole W, Stapel LC, Romeijn RJ, Tijsterman M.
A broad requirement for TLS polymerases η and κ, and interacting sumoylation and nuclear pore proteins, in lesion bypass during C. elegans embryogenesis.
PLoS Genet. 2012 8(6) e1002800 
[ PubMed ID = 22761594 ] [ RRC reference ]

Koon JC, Kubiseski TJ.
Developmental arrest of Caenorhabditis elegans BRAP-2 mutant exposed to oxidative stress is dependent on BRC-1.
J. Biol. Chem. 2010 285(18) 13437-43 
[ PubMed ID = 20207739 ] [ RRC reference ]

D'Amora DR, Hu Q, Pizzardi M, Kubiseski TJ.
BRAP-2 promotes DNA damage induced germline apoptosis in C. elegans through the regulation of SKN-1 and AKT-1.
Cell Death Differ. 2018 25(7) 1276-1288 
[ PubMed ID = 29358669 ] [ RRC reference ]

Pontier DB, Tijsterman M.
A robust network of double-strand break repair pathways governs genome integrity during C. elegans development.
Curr. Biol. 2009 19(16) 1384-8 
[ PubMed ID = 19646877 ] [ RRC reference ]

Polanowska J, Martin JS, Garcia-Muse T, Petalcorin MI, Boulton SJ.
A conserved pathway to activate BRCA1-dependent ubiquitylation at DNA damage sites.
EMBO J. 2006 25(10) 2178-88 
[ PubMed ID = 16628214 ] [ RRC reference ]

Labocha MK, Jung SK, Aleman-Meza B, Liu Z, Zhong W.
WormGender - Open-Source Software for Automatic Caenorhabditis elegans Sex Ratio Measurement.
PLoS ONE 2015 10(9) e0139724 
[ PubMed ID = 26421844 ] [ RRC reference ]

Wolters S, Ermolaeva MA, Bickel JS, Fingerhut JM, Khanikar J, Chan RC, Schumacher B.
Loss of Caenorhabditis elegans BRCA1 promotes genome stability during replication in smc-5 mutants.
Genetics 2014 196(4) 985-99 
[ PubMed ID = 24424777 ] [ RRC reference ]

Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79 
[ PubMed ID = 22665589 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev. Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]

Couteau F, Zetka M.
DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly.
Dev. Cell 2011 20(3) 353-63 
[ PubMed ID = 21397846 ] [ RRC reference ]

Labocha MK, Yuan W, Aleman-Meza B, Zhong W.
A strategy to apply quantitative epistasis analysis on developmental traits.
BMC Genet. 2017 18(1) 42 
[ PubMed ID = 28506208 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet. 2013 9(2) e1003276 
[ PubMed ID = 23408909 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ. 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864 
[ PubMed ID = 28634159 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885 
[ PubMed ID = 29046436 ] [ RRC reference ]

Ward JD, Barber LJ, Petalcorin MI, Yanowitz J, Boulton SJ.
Replication blocking lesions present a unique substrate for homologous recombination.
EMBO J. 2007 26(14) 3384-96 
[ PubMed ID = 17611606 ] [ RRC reference ]