Mutants (Isolated)

tm1145

Allele Nametm1145
Sequence NameC36A4.8
CGC Namebrc-1
Worm BaseAllele Name tm1145
CGC Name brc-1
Sequence C36A4.8
Phenotypehomozygous viable. Dr. A. Dernburg: nonHim, normal meiosis. Dr. S. Boulton: EMBO J, 24, 4345-4355 (2005), Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006)
Mutation site33302/33303-33971/33972 (669 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24651..24899, 25595..25768, 29731..29849, 32650..33031, 33094..33167, 33217..33445, 33902..34247, 34301..34371))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AATATAGGCACCGGCGGGGA,ExtRev:CTCCGTAGCTTGAAGTCTCA,IntFwd:TGTCGCATCGTCGGCATTAA,ExtFwd:TTTCGGTGGCGCCACATGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Padeken J, Zeller P, Towbin B, Katic I, Kalck V, Methot SP, Gasser SM.
Synergistic lethality between BRCA1 and H3K9me2 loss reflects satellite derepression.
Genes Dev. 2019 33(7-8) 436-451 
[ PubMed ID = 30804228 ] [ RRC reference ]

Fang EF, Hou Y, Lautrup S, Jensen MB, Yang B, SenGupta T, Caponio D, Khezri R, Demarest TG, Aman Y, Figueroa D, Morevati M, Lee HJ, Kato H, Kassahun H, Lee JH, Filippelli D, Okur MN, Mangerich A, Croteau DL, Maezawa Y, Lyssiotis CA, Tao J, Yokote K, Rusten TE, Mattson MP, Jasper H, Nilsen H, Bohr VA.
NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
Nat Commun 2019 10(1) 5284 
[ PubMed ID = 31754102 ] [ RRC reference ]

Chou WY, Lin YC, Lee YH.
Short-term starvation stress at young adult stages enhances meiotic activity of germ cells to maintain spermatogenesis in aged male Caenorhabditis elegans.
Aging Cell 2019 18(3) e12930 
[ PubMed ID = 30816005 ] [ RRC reference ]

Park S, Choi S, Ahn B.
DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay.
Mol. Cells 2016 39(3) 204-10 
[ PubMed ID = 26903030 ] [ RRC reference ]

Hyun M, Choi S, Stevnsner T, Ahn B.
The Caenorhabditis elegans Werner syndrome protein participates in DNA damage checkpoint and DNA repair in response to CPT-induced double-strand breaks.
Cell. Signal. 2016 28(3) 214-223 
[ PubMed ID = 26691982 ] [ RRC reference ]

Hong Y, Sonneville R, Agostinho A, Meier B, Wang B, Blow JJ, Gartner A.
The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.
PLoS Genet. 2016 12(3) e1005872 
[ PubMed ID = 27010650 ] [ RRC reference ]

Germoglio M, Valenti A, Gallo I, Forenza C, Santonicola P, Silva N, Adamo A.
In vivo analysis of FANCD2 recruitment at meiotic DNA breaks in Caenorhabditis elegans.
Sci Rep 2020 10(1) 103 
[ PubMed ID = 31919410 ] [ RRC reference ]

D'Amora DR, Hu Q, Pizzardi M, Kubiseski TJ.
BRAP-2 promotes DNA damage induced germline apoptosis in C. elegans through the regulation of SKN-1 and AKT-1.
Cell Death Differ. 2018 25(7) 1276-1288 
[ PubMed ID = 29358669 ] [ RRC reference ]

Koon JC, Kubiseski TJ.
Developmental arrest of Caenorhabditis elegans BRAP-2 mutant exposed to oxidative stress is dependent on BRC-1.
J. Biol. Chem. 2010 285(18) 13437-43 
[ PubMed ID = 20207739 ] [ RRC reference ]

Roerink SF, Koole W, Stapel LC, Romeijn RJ, Tijsterman M.
A broad requirement for TLS polymerases η and κ, and interacting sumoylation and nuclear pore proteins, in lesion bypass during C. elegans embryogenesis.
PLoS Genet. 2012 8(6) e1002800 
[ PubMed ID = 22761594 ] [ RRC reference ]

Ryu JS, Kang SJ, Koo HS.
The 53BP1 homolog in C. elegans influences DNA repair and promotes apoptosis in response to ionizing radiation.
PLoS ONE 2013 8(5) e64028 
[ PubMed ID = 23667696 ] [ RRC reference ]

Butuči M, Williams AB, Wong MM, Kramer B, Michael WM.
Zygotic Genome Activation Triggers Chromosome Damage and Checkpoint Signaling in C. elegans Primordial Germ Cells.
Dev. Cell 2015 34(1) 85-95 
[ PubMed ID = 26073019 ] [ RRC reference ]

Couteau F, Zetka M.
DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly.
Dev. Cell 2011 20(3) 353-63 
[ PubMed ID = 21397846 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev. Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]

Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79 
[ PubMed ID = 22665589 ] [ RRC reference ]

Wolters S, Ermolaeva MA, Bickel JS, Fingerhut JM, Khanikar J, Chan RC, Schumacher B.
Loss of Caenorhabditis elegans BRCA1 promotes genome stability during replication in smc-5 mutants.
Genetics 2014 196(4) 985-99 
[ PubMed ID = 24424777 ] [ RRC reference ]

Labocha MK, Jung SK, Aleman-Meza B, Liu Z, Zhong W.
WormGender - Open-Source Software for Automatic Caenorhabditis elegans Sex Ratio Measurement.
PLoS ONE 2015 10(9) e0139724 
[ PubMed ID = 26421844 ] [ RRC reference ]

Labocha MK, Yuan W, Aleman-Meza B, Zhong W.
A strategy to apply quantitative epistasis analysis on developmental traits.
BMC Genet. 2017 18(1) 42 
[ PubMed ID = 28506208 ] [ RRC reference ]

Lawrence KS, Tapley EC, Cruz VE, Li Q, Aung K, Hart KC, Schwartz TU, Starr DA, Engebrecht J.
LINC complexes promote homologous recombination in part through inhibition of nonhomologous end joining.
J. Cell Biol. 2016 215(6) 801-821 
[ PubMed ID = 27956467 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ. 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]