Mutants (Isolated)

tm1144

Allele Nametm1144
Sequence NameM03D4.6
CGC NameM03D4.6
Worm BaseAllele Name tm1144
CGC Name M03D4.6
Sequence M03D4.6
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site37469/37470-TCCAAANCNNNCCCTGGANCTTGGCCCGATGAGGAATNGAATNCCAACCTT-38068/38069 (599 bp deletion + 51 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(35290..35386, 35488..35777, 36123..36377, 36427..36516, 36606..36711, 36957..37201, 37785..38170, 38630..38732))
Map position3.04
Balancer
Map position of balancer
Sequence of primersExtFwd:GATCTGCCTAGTTTTCCCCA,IntFwd:ACTCGTTCCCCTCTCGCGTA,ExtRev:CCAGCCTATTCCATCCTGAT,IntRev:TCCGAGCTGATAATGTCGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat. Genet. 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]