Allele Name | tm1127 |
Sequence Name | Y49F6A.1 |
CGC Name | wago-11 |
Worm Base | Allele Name |
tm1127
|
CGC Name |
wago-11
|
Sequence |
Y49F6A.1
|
Phenotype | homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). |
Mutation site | 16762/16763-GN-17485/17486 (723 bp deletion + 2 bp insertion) |
Chromosome | II |
Putative gene structure | join(16538..16583, 16650..16733, 17122..17335, 17386..18118, 18275..18484, 18533..18846, 19031..19627, 19676..20027, 20087..20277, 20376..20535) |
Map position | -6.24 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:AGTCATGGCGGATTGCTGAA,IntRev:AGCTTAAGTCTGACCACGTT,ExtFwd:TGGAATCGAAAGCGAACGTC,IntFwd:ATCAAGAGCCATACCGCATC |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E, Ketting RF. Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans. EMBO J 2012 31(16) 3422-30
[ PubMed ID = 22850670 ]
[ RRC reference ]
|
Hall SE, Chirn GW, Lau NC, Sengupta P. RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans. RNA 2013 19(3) 306-19
[ PubMed ID = 23329696 ]
[ RRC reference ]
|
Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S. Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans. Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ]
[ RRC reference ]
|
Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A. Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans. mBio 2017 8(5)
[ PubMed ID = 29018118 ]
[ RRC reference ]
|
|