Mutants (Isolated)

tm1126

Allele Nametm1126
Sequence NameC47G2.1
CGC Namecut-1
Worm BaseAllele Name tm1126
CGC Name cut-1
Sequence C47G2.1
Phenotypehomozygous viable. Dr. P. Bazzicalupo: Dev. Biol.282, 231-245 (2005).
Mutation site2902/2903-3513/3514 (611 bp deletion)
ChromosomeIII
Putative gene structurejoin(2562..2679, 2992..3217, 3898..4636, 4687..4878)
Map position3.39
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGACCGAAAATTCTGGGAC,IntFwd:AAGCCCTTATACGACCTCTA,ExtRev:GGGGAGGCTCCCTGGAATAT,IntRev:ACTGAGCAAGTGTGGCACGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sapio MR, Hilliard MA, Cermola M, Favre R, Bazzicalupo P.
The Zona Pellucida domain containing proteins, CUT-1, CUT-3 and CUT-5, play essential roles in the development of the larval alae in Caenorhabditis elegans.
Dev. Biol. 2005 282(1) 231-45 
[ PubMed ID = 15936343 ] [ RRC reference ]

Gilleland CL, Falls AT, Noraky J, Heiman MG, Yanik MF.
Computer-Assisted Transgenesis of Caenorhabditis elegans for Deep Phenotyping.
Genetics 2015 201(1) 39-46 
[ PubMed ID = 26163188 ] [ RRC reference ]