Mutants (Isolated)

tm1125

Allele Nametm1125
Allele TypeNormal
Sequence NameW06B4.3
Gene NameW06B4.3
Worm BaseAllele Name tm1125
Gene Name W06B4.3
Sequence W06B4.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Herman: unable to score because of inviablity. Dr. M. Barr: small body size, few dauers observed on starved plate, male mating behavior abnormal. Dr. C. Yang: slightly Dpy, cell corpses degradation defects. Dr. J. Kaplan: Gro, small brood size. Dr. Z. Zhou: persistent cell corpses in adult gonad.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 703/704-1287/1288 (584 bp deletion)
ChromosomeII
Putative gene structurejoin(100..878, 1507..1893, 2550..3375, 4221..4614, 5494..6073, 6335..6401)
Map position-4.38
Balancer
Map position of balancer
Sequence of primersExtRev:CTCATATAAACAGCTGCGGT,IntRev:GCGGTAAGGCTGGAAGGGAA,ExtFwd:TACAGCGAAGGCACTGGGGA,IntFwd:CTGGGGAGAGGCATCAAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication