Mutants (Isolated)

tm1125

Allele Nametm1125
Sequence NameW06B4.3
CGC NameW06B4.3
Worm BaseAllele Name tm1125
CGC Name W06B4.3
Sequence W06B4.3
Phenotypehomozygous viable. Dr. G. Herman: unable to score because of inviablity. Dr. M. Barr: small body size, few dauers observed on starved plate, male mating behavior abnormal. Dr. C. Yang: slightly Dpy, cell corpses degradation defects. Dr. J. Kaplan: Gro, small brood size. Dr. Z. Zhou: persistent cell corpses in adult gonad.
Mutation site703/704-1287/1288 (584 bp deletion)
ChromosomeII
Putative gene structurejoin(100..878, 1507..1893, 2550..3375, 4221..4614, 5494..6073, 6335..6401)
Map position-4.38
Balancer
Map position of balancer
Sequence of primersExtRev:CTCATATAAACAGCTGCGGT,IntRev:GCGGTAAGGCTGGAAGGGAA,ExtFwd:TACAGCGAAGGCACTGGGGA,IntFwd:CTGGGGAGAGGCATCAAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Solinger JA, Spang A.
Loss of the Sec1/Munc18-family proteins VPS-33.2 and VPS-33.1 bypasses a block in endosome maturation in Caenorhabditis elegans.
Mol. Biol. Cell 2014 25(24) 3909-25 
[ PubMed ID = 25273556 ] [ RRC reference ]

Li Y, Zhang Y, Gan Q, Xu M, Ding X, Tang G, Liang J, Liu K, Liu X, Wang X, Guo L, Gao Z, Hao X, Yang C.
C. elegans-based screen identifies lysosome-damaging alkaloids that induce STAT3-dependent lysosomal cell death.
Protein Cell 2018 9(12) 1013-1026 
[ PubMed ID = 29611115 ] [ RRC reference ]

Xu M, Liu Y, Zhao L, Gan Q, Wang X, Yang C.
The lysosomal cathepsin protease CPL-1 plays a leading role in phagosomal degradation of apoptotic cells in Caenorhabditis elegans.
Mol. Biol. Cell 2014 25(13) 2071-83 
[ PubMed ID = 24829385 ] [ RRC reference ]

Chen D, Jian Y, Liu X, Zhang Y, Liang J, Qi X, Du H, Zou W, Chen L, Chai Y, Ou G, Miao L, Wang Y, Yang C.
Clathrin and AP2 are required for phagocytic receptor-mediated apoptotic cell clearance in Caenorhabditis elegans.
PLoS Genet. 2013 9(5) e1003517 
[ PubMed ID = 23696751 ] [ RRC reference ]

Wu YE, Huo L, Maeder CI, Feng W, Shen K.
The balance between capture and dissociation of presynaptic proteins controls the spatial distribution of synapses.
Neuron 2013 78(6) 994-1011 
[ PubMed ID = 23727120 ] [ RRC reference ]

Xiao H, Chen D, Fang Z, Xu J, Sun X, Song S, Liu J, Yang C.
Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans.
Mol. Biol. Cell 2009 20(1) 21-32 
[ PubMed ID = 18923146 ] [ RRC reference ]

Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H.
Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(11) E978-87 
[ PubMed ID = 24591580 ] [ RRC reference ]

Xu J, Sun X, Jing Y, Wang M, Liu K, Jian Y, Yang M, Cheng Z, Yang C.
MRG-1 is required for genomic integrity in Caenorhabditis elegans germ cells.
Cell Res. 2012 22(5) 886-902 
[ PubMed ID = 22212480 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol. Biol. Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J. Cell Biol. 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]