Mutants (Isolated)

tm1120

Allele Nametm1120
Sequence NameY110A7A.18
CGC Nameppw-2
Worm BaseAllele Name tm1120
CGC Name ppw-2
Sequence Y110A7A.18
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site59817/59818-60762/60763 (945 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(58180..58297, 58349..58716, 58764..59006, 59051..59225, 59272..59440, 59485..59660, 59709..60432, 60477..60882, 60927..61095, 61144..61334, 61381..61569))
Map position-0.35
Balancer
Map position of balancer
Sequence of primersIntRev:CGGTTCCACCGGTAACAATG,ExtRev:ACAATGCCTGCTACACCGGT,IntFwd:CGATAGCATCAGGGGTGAGA,ExtFwd:CGCAGCCTCACGCAAACGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol. Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]