Mutants (Isolated)

tm1113

Allele Nametm1113
Sequence NameZK1248.7
CGC Namewago-5
Worm BaseAllele Name tm1113
CGC Name wago-5
Sequence ZK1248.7
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site3509/3510-4099/4100 (590 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(2854..2965, 3022..3317, 3360..3599, 3648..3994, 4045..4220, 4264..4419, 4458..5192, 5236..5816, 5866..5961))
Map position-0.93
Balancer
Map position of balancer
Sequence of primersExtRev:GATTCGAGTTGCCGATGGGA,IntRev:GACGTGTTCAATCGCCGAGT,ExtFwd:GGTGATAGAGCAAGCGAACT,IntFwd:AAGTATGAGGATGCACCGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol. Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]