Mutants (Isolated)

tm1107

Allele Nametm1107
Sequence NameD2013.5
CGC Nameeat-3
Worm BaseAllele Name tm1107
CGC Name eat-3
Sequence D2013.5
Phenotypelethal or sterile. Dr. D. Xue: Mol Cell 31, 586 (2008)
Mutation site27442/27443-27859/27860 (417 bp deletion)
ChromosomeII
Putative gene structurejoin(25280..25440, 26057..26198, 26334..26574, 26952..27187, 27235..27767, 27817..28315, 28406..28609, 28654..29106, 29160..29427, 29611..29678)
Map position1.27
Balancer
Map position of balancer
Sequence of primersExtFwd:AGACCATGTGCTCACTCGGA,IntFwd:TCTAAGCACTCTTCACCTTG,ExtRev:ATCCCGTAGTAACTGGCTTG,IntRev:TCATCGATCGAATCCGAACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kanazawa T, Zappaterra MD, Hasegawa A, Wright AP, Newman-Smith ED, Buttle KF, McDonald K, Mannella CA, van der Bliek AM.
The C. elegans Opa1 homologue EAT-3 is essential for resistance to free radicals.
PLoS Genet. 2008 4(2) e1000022 
[ PubMed ID = 18454199 ] [ RRC reference ]

Johnson D, Allman E, Nehrke K.
Regulation of acid-base transporters by reactive oxygen species following mitochondrial fragmentation.
Am. J. Physiol., Cell Physiol. 2012 302(7) C1045-54 
[ PubMed ID = 22237403 ] [ RRC reference ]

Johnson D, Nehrke K.
Mitochondrial fragmentation leads to intracellular acidification in Caenorhabditis elegans and mammalian cells.
Mol. Biol. Cell 2010 21(13) 2191-201 
[ PubMed ID = 20444981 ] [ RRC reference ]

Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, Laboy R, Hirschey MD, Mair WB.
Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling.
Cell Metab. 2017 26(6) 884-896.e5 
[ PubMed ID = 29107506 ] [ RRC reference ]

Rolland SG, Motori E, Memar N, Hench J, Frank S, Winklhofer KF, Conradt B.
Impaired complex IV activity in response to loss of LRPPRC function can be compensated by mitochondrial hyperfusion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(32) E2967-76 
[ PubMed ID = 23878239 ] [ RRC reference ]

Breckenridge DG, Kang BH, Kokel D, Mitani S, Staehelin LA, Xue D.
Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9.
Mol. Cell 2008 31(4) 586-97 
[ PubMed ID = 18722182 ] [ RRC reference ]