Mutants (Isolated)

tm1103

Allele Nametm1103
Allele TypeNormal
Sequence NameF55B12.1
Gene Nameceh-24
Worm BaseAllele Name tm1103
Gene Name ceh-24
Sequence F55B12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4519/4520-ATGTACGTT-5010/5011 (490 bp deletion + 8 bp insertion)
ChromosomeV
Putative gene structurejoin(4302..4411, 4457..4521, 4906..5108, 5153..5277, 5325..5412, 5464..5571)
Map position5.6
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCTTGGAAGTATGAGCGAG,IntFwd:TCCTAACCGGCGTCGAATAA,ExtRev:ACGCATATAATAGGCGGGAT,IntRev:AGGCGGGATTCGGTCCTTGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Schwarz J, Bringmann H.
Analysis of the NK2 homeobox gene ceh-24 reveals sublateral motor neuron control of left-right turning during sleep.
Elife 2017 6  
[ PubMed ID = 28244369 ] [ RRC reference ]