Home > Mutants (Isolated) > tm1098

Mutants (Isolated)

Allele Name		tm1098
Allele Type		Normal
Sequence Name		F27D4.6
Gene Name		F27D4.6
Worm Base	Allele Name	tm1098
	Gene Name	F27D4.6
	Sequence	F27D4.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		33302/33303-33687/33688 (385 bp deletion)
Chromosome		I
Putative gene structure		join(28719..28756,29602..29708,29755..29913,29960..30129, 30389..30575, 30650..30703, 30819..31015, 31234..31465, 31515..31597, 31650..31760, 31811..32142, 32189..32235, 32284..32363, 32409..32519, 32564..32702, 32750..32806, 33016..33095, 33140..33247, 33292..33439, 33489..33548, 33784..33816, 33865..34097, 34145..34271, 34328..34629, 34784..34931, 35017..35126, 35174..35260, 35304..35393)
Map position		2.32
Balancer
Map position of balancer
Sequence of primers		ExtRev:CTGCTTGATTTGACCACAGT,IntRev:CTCTCATACTCACTGGCGTA,ExtFwd:TTTGTATCAACGGCACCCGA,IntFwd:AACACCCCACCTAGAAAGGT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Le Pen J, Jiang H, Di Domenico T, Kneuss E, Kosałka J, Leung C, Morgan M, Much C, Rudolph KLM, Enright AJ, O'Carroll D, Wang D, Miska EA. Terminal uridylyltransferases target RNA viruses as part of the innate immune system. Nat Struct Mol Biol 2018 25(9) 778-786  [ PubMed ID = 30104661 ] [ RRC reference ]