Mutants (Isolated)

tm1098

Allele Nametm1098
Sequence NameF27D4.6
CGC NameF27D4.6
Worm BaseAllele Name tm1098
CGC Name F27D4.6
Sequence F27D4.6
Phenotypehomozygous viable
Mutation site33302/33303-33687/33688 (385 bp deletion)
ChromosomeI
Putative gene structurejoin(28719..28756,29602..29708,29755..29913,29960..30129, 30389..30575, 30650..30703, 30819..31015, 31234..31465, 31515..31597, 31650..31760, 31811..32142, 32189..32235, 32284..32363, 32409..32519, 32564..32702, 32750..32806, 33016..33095, 33140..33247, 33292..33439, 33489..33548, 33784..33816, 33865..34097, 34145..34271, 34328..34629, 34784..34931, 35017..35126, 35174..35260, 35304..35393)
Map position2.32
Balancer
Map position of balancer
Sequence of primersExtRev:CTGCTTGATTTGACCACAGT,IntRev:CTCTCATACTCACTGGCGTA,ExtFwd:TTTGTATCAACGGCACCCGA,IntFwd:AACACCCCACCTAGAAAGGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Le Pen J, Jiang H, Di Domenico T, Kneuss E, Kosałka J, Leung C, Morgan M, Much C, Rudolph KLM, Enright AJ, O'Carroll D, Wang D, Miska EA.
Terminal uridylyltransferases target RNA viruses as part of the innate immune system.
Nat Struct Mol Biol 2018 25(9) 778-786 
[ PubMed ID = 30104661 ] [ RRC reference ]