Mutants (Isolated)

tm1097

Allele Nametm1097
Sequence NameF20B4.6
CGC Namecgt-2
Worm BaseAllele Name tm1097
CGC Name cgt-2
Sequence F20B4.6
Phenotypehomozygous viable
Mutation site9324/9325-9748/9749 (424 bp deletion)
ChromosomeX
Putative gene structurejoin(6817..7064, 8321..8556, 8602..8822, 9048..9371, 10039..10170, 11596..11766)
Map position24.62
Balancer
Map position of balancer
Sequence of primersExtRev:GAAAGTATCGACTCCACCGT,IntRev:CCAACCCTTCACTACCCGGA,ExtFwd:CCACGCATCTTATGGCTGTA,IntFwd:TGCAGAAGGGAAGCAATCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Marza E, Simonsen KT, Faergeman NJ, Lesa GM.
Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells.
J. Cell. Sci. 2009 122(Pt 6) 822-33 
[ PubMed ID = 19240113 ] [ RRC reference ]