Mutants (Isolated)

tm1095

Allele Nametm1095
Sequence NameK02B12.4
CGC Nameaxl-1
Worm BaseAllele Name tm1095
CGC Name axl-1
Sequence K02B12.4
Phenotypehomozygous viable. Dr. H.C. Korswagen: enhances the pry-1 (mu38) phenotype, axon guidance and excretory cell developmental defect. Dr. H. Sawa: not Psa but enhanced pry-1 Muv, PVul. Dr. S. Shaham: no obvious defects in glia development.
Mutation site22907/22908-23524/23525 (617 bp deletion)
ChromosomeI
Putative gene structurejoin(22267..22332, 22971..23020, 23130..23255, 23299..23463, 23734..23810, 23859..23943, 23991..24150)
Map position2.89
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGTTGTTTGTTCCCGTAA,ExtFwd:CTACCCCACTTGCCATACTT,IntFwd:CGTTTTTCCGTAGAACCGCA,ExtRev:ATCTTTGCCACCATCGGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu H, Dowdle JA, Khurshid S, Sullivan NJ, Bertos N, Rambani K, Mair M, Daniel P, Wheeler E, Tang X, Toth K, Lause M, Harrigan ME, Eiring K, Sullivan C, Sullivan MJ, Chang SW, Srivastava S, Conway JS, Kladney R, McElroy J, Bae S, Lu Y, Tofigh A, Saleh SMI, Fernandez SA, Parvin JD, Coppola V, Macrae ER, Majumder S, Shapiro CL, Yee LD, Ramaswamy B, Hallett M, Ostrowski MC, Park M, Chamberlin HM, Leone G.
Discovery of Stromal Regulatory Networks that Suppress Ras-Sensitized Epithelial Cell Proliferation.
Dev. Cell 2017 41(4) 392-407.e6 
[ PubMed ID = 28535374 ] [ RRC reference ]

Park EC, Rongo C.
RPM-1 and DLK-1 regulate pioneer axon outgrowth by controlling Wnt signaling.
Development 2018 145(18)  
[ PubMed ID = 30093552 ] [ RRC reference ]

Oosterveen T, Coudreuse DY, Yang PT, Fraser E, Bergsma J, Dale TC, Korswagen HC.
Two functionally distinct Axin-like proteins regulate canonical Wnt signaling in C. elegans.
Dev. Biol. 2007 308(2) 438-48 
[ PubMed ID = 17601533 ] [ RRC reference ]