Mutants (Isolated)

tm1094

Allele Nametm1094
Sequence NameC01G5.2
CGC Nameprg-2
Worm BaseAllele Name tm1094
CGC Name prg-2
Sequence C01G5.2
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site14468/14469-AAACAAGTGTTTAACAATTAAACAAGT-15533/15534 (1065 bp deletion + 27 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(13134..13289, 13335..13521, 13564..13801, 13849..14023, 14071..14435, 14479..14920, 14968..15210, 15380..15568, 15613..15786))
Map position3.2
Balancer
Map position of balancer
Sequence of primersIntRev:CGGGCCAACCATCAAAATGA,ExtRev:CTGGGAACTATCCAACCCGA,IntFwd:ATCTTACTTCGGACGAAGTG,ExtFwd:CAGCACCATCTCTGTAGAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC.
PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans.
Mol. Cell 2008 31(1) 67-78 
[ PubMed ID = 18571452 ] [ RRC reference ]

Wang G, Reinke V.
A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis.
Curr. Biol. 2008 18(12) 861-7 
[ PubMed ID = 18501605 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]