Mutants (Isolated)

tm1094

Allele Nametm1094
Allele TypeNormal
Sequence NameC01G5.2
Gene Nameprg-2
Worm BaseAllele Name tm1094
Gene Name prg-2
Sequence C01G5.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14468/14469-AAACAAGTGTTTAACAATTAAACAAGT-15533/15534 (1065 bp deletion + 27 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(13134..13289, 13335..13521, 13564..13801, 13849..14023, 14071..14435, 14479..14920, 14968..15210, 15380..15568, 15613..15786))
Map position3.2
Balancer
Map position of balancer
Sequence of primersIntRev:CGGGCCAACCATCAAAATGA,ExtRev:CTGGGAACTATCCAACCCGA,IntFwd:ATCTTACTTCGGACGAAGTG,ExtFwd:CAGCACCATCTCTGTAGAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shukla A, Perales R, Kennedy S.
piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.
Curr Biol 2021 31(20) 4473-4485.e3 
[ PubMed ID = 34428467 ] [ RRC reference ]

Pereira AG, Gracida X, Kagias K, Zhang Y.
C. elegans aversive olfactory learning generates diverse intergenerational effects.
J Neurogenet 2020 34(3-4) 378-388 
[ PubMed ID = 32940103 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Wang G, Reinke V.
A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis.
Curr Biol 2008 18(12) 861-7 
[ PubMed ID = 18501605 ] [ RRC reference ]

Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC.
PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans.
Mol Cell 2008 31(1) 67-78 
[ PubMed ID = 18571452 ] [ RRC reference ]