Allele Name | tm1094 |
Allele Type | Normal |
Sequence Name | C01G5.2 |
Gene Name | prg-2 |
Worm Base | Allele Name |
tm1094
|
Gene Name |
prg-2
|
Sequence |
C01G5.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 14468/14469-AAACAAGTGTTTAACAATTAAACAAGT-15533/15534 (1065 bp deletion + 27 bp insertion) |
Chromosome | IV |
Putative gene structure | complement(join(13134..13289, 13335..13521, 13564..13801, 13849..14023, 14071..14435, 14479..14920, 14968..15210, 15380..15568, 15613..15786)) |
Map position | 3.2 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CGGGCCAACCATCAAAATGA,ExtRev:CTGGGAACTATCCAACCCGA,IntFwd:ATCTTACTTCGGACGAAGTG,ExtFwd:CAGCACCATCTCTGTAGAGA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Shukla A, Perales R, Kennedy S. piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing. Curr Biol 2021 31(20) 4473-4485.e3
[ PubMed ID = 34428467 ]
[ RRC reference ]
|
Pereira AG, Gracida X, Kagias K, Zhang Y. C. elegans aversive olfactory learning generates diverse intergenerational effects. J Neurogenet 2020 34(3-4) 378-388
[ PubMed ID = 32940103 ]
[ RRC reference ]
|
Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S. Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans. Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ]
[ RRC reference ]
|
Wang G, Reinke V. A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis. Curr Biol 2008 18(12) 861-7
[ PubMed ID = 18501605 ]
[ RRC reference ]
|
Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC. PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Mol Cell 2008 31(1) 67-78
[ PubMed ID = 18571452 ]
[ RRC reference ]
|
|