Mutants (Isolated)

tm1093

Allele Nametm1093
Sequence NameY46H3A.2
CGC Namehsp-16.41
Worm BaseAllele Name tm1093
CGC Name hsp-16.41
Sequence Y46H3A.2
Phenotypehomozygous viable. Dr. I. Mori: weakly abnormal thermotaxis when cultured at 17 C.
Mutation site4185/4186-CTTTCAAATGATT-4457/4458 (272 bp deletion + 13 bp insertion)
ChromosomeV
Putative gene structurejoin(3823..3960, 4019..4312)
Map position-17.43
Balancer
Map position of balancer
Sequence of primersIntRev:ACCGCGAATCGGAAAATTGC,ExtRev:GTATGGTGGGCGACATACGA,IntFwd:GATAGCGTACGACCATCCAA,ExtFwd:CTCCTTGGATTGATAGCGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]

Sugi T, Nishida Y, Mori I.
Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans.
Nat. Neurosci. 2011 14(8) 984-92 
[ PubMed ID = 21706021 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]