Mutants (Isolated)

tm1092

Allele Nametm1092
Sequence NameF07G6.1
CGC Namedgn-3
Worm BaseAllele Name tm1092
CGC Name dgn-3
Sequence F07G6.1
Phenotypehomozygous viable. Dr. S. McIntire: normal development and locomotion.
Mutation site27727/27728-28456/28457 (729 bp deletion)
ChromosomeX
Putative gene structurejoin(27429..27742, 28949..29363, 29478..29629, 29675..29789)
Map position-17.65
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGAGCTTATGAGAGCCCTA,IntFwd:CTCCGAGCTGACACTTGGAT,IntRev:TCTTCCAGCACTGCGTTTCT,ExtRev:TGTCGCCACTCTCCGATAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Qin J, Liang J, Ding M.
Perlecan antagonizes collagen IV and ADAMTS9/GON-1 in restricting the growth of presynaptic boutons.
J. Neurosci. 2014 34(31) 10311-24 
[ PubMed ID = 25080592 ] [ RRC reference ]

Trzebiatowska A, Topf U, Sauder U, Drabikowski K, Chiquet-Ehrismann R.
Caenorhabditis elegans teneurin, ten-1, is required for gonadal and pharyngeal basement membrane integrity and acts redundantly with integrin ina-1 and dystroglycan dgn-1.
Mol. Biol. Cell 2008 19(9) 3898-908 
[ PubMed ID = 18632986 ] [ RRC reference ]