Mutants (Isolated)

tm1086

Allele Nametm1086
BalanceCompleted
OutCrossNot Accepted
Sequence NameT07E3.5
Gene Namebrc-2
Worm BaseAllele Name tm1086 (x1)
Gene Name brc-2
Sequence T07E3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. S. Boulton: Mol Cell Biol 25, 3127-3139 (2005)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3949/3950-4621/4622 (672 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(2953..2994, 3368..3485, 3551..3678, 3918..4014, 4061..4145, 4189..4311, 4363..4536, 4620..4759, 4804..4907, 5003..5153, 5229..5251))
Map position-0.91
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtRev:TTACGCTCCACCGGACAGTA,ExtFwd:TAACAGGGCGGAACACATAG,IntFwd:CCGGAGAAGTCCATAACTCG,IntRev:TGTGACATCGACCGATGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Trivedi S, Blazícková J, Silva N.
PARG and BRCA1-BARD1 cooperative function regulates DNA repair pathway choice during gametogenesis.
Nucleic Acids Res 2022 50(21) 12291-12308 
[ PubMed ID = 36478097 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856 
[ PubMed ID = 30242011 ] [ RRC reference ]

Shimizu T, Pastuhov SI, Hanafusa H, Matsumoto K, Hisamoto N.
The C. elegans BRCA2-ALP/Enigma Complex Regulates Axon Regeneration via a Rho GTPase-ROCK-MLC Phosphorylation Pathway.
Cell Rep 2018 24(7) 1880-1889 
[ PubMed ID = 30110643 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Gao J, Kim HM, Elia AE, Elledge SJ, Colaiácovo MP.
NatB domain-containing CRA-1 antagonizes hydrolase ACER-1 linking acetyl-CoA metabolism to the initiation of recombination during C. elegans meiosis.
PLoS Genet 2015 11(3) e1005029 
[ PubMed ID = 25768301 ] [ RRC reference ]

Saito TT, Mohideen F, Meyer K, Harper JW, Colaiácovo MP.
SLX-1 is required for maintaining genomic integrity and promoting meiotic noncrossovers in the Caenorhabditis elegans germline.
PLoS Genet 2012 8(8) e1002888 
[ PubMed ID = 22927825 ] [ RRC reference ]

Martrat G, Maxwell CM, Tominaga E, Porta-de-la-Riva M, Bonifaci N, Gómez-Baldó L, Bogliolo M, Lázaro C, Blanco I, Brunet J, Aguilar H, Fernández-Rodríguez J, Seal S, Renwick A, Rahman N, Kühl J, Neveling K, Schindler D, Ramírez MJ, Castellà M, Hernández G, EMBRACE, Easton DF, Peock S, Cook M, Oliver CT, Frost D, Platte R, Evans DG, Lalloo F, Eeles R, Izatt L, Chu C, Davidson R, Ong KR, Cook J, Douglas F, Hodgson S, Brewer C, Morrison PJ, Porteous M, Peterlongo P, Manoukian S, Peissel B, Zaffaroni D, Roversi G, Barile M, Viel A, Pasini B, Ottini L, Putignano AL, Savarese A, Bernard L, Radice P, Healey S, Spurdle A, Chen X, Beesley J, kConFab, Rookus MA, Verhoef S, Tilanus-Linthorst MA, Vreeswijk MP, Asperen CJ, Bodmer D, Ausems MG, van Os TA, Blok MJ, Meijers-Heijboer HE, Hogervorst FB, HEBON, Goldgar DE, Buys S, John EM, Miron A, Southey M, Daly MB, BCFR, SWE-BRCA, Harbst K, Borg A, Rantala J, Barbany-Bustinza G, Ehrencrona H, Stenmark-Askmalm M, Kaufman B, Laitman Y, Milgrom R, Friedman E, Domchek SM, Nathanson KL, Rebbeck TR, Johannsson OT, Couch FJ, Wang X, Fredericksen Z, Cuadras D, Moreno V, Pientka FK, Depping R, Caldés T, Osorio A, Benítez J, Bueren J, Heikkinen T, Nevanlinna H, Hamann U, Torres D, Caligo MA, Godwin AK, Imyanitov EN, Janavicius R, GEMO Study Collaborators, Sinilnikova OM, Stoppa-Lyonnet D, Mazoyer S, Verny-Pierre C, Castera L, de Pauw A, Bignon YJ, Uhrhammer N, Peyrat JP, Vennin P, Ferrer SF, Collonge-Rame MA, Mortemousque I, McGuffog L, Chenevix-Trench G, Pereira-Smith OM, Antoniou AC, Cerón J, Tominaga K, Surrallés J, Pujana MA.
Exploring the link between MORF4L1 and risk of breast cancer.
Breast Cancer Res 2011 13(2) R40 
[ PubMed ID = 21466675 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]

Pispa J, Palmén S, Holmberg CI, Jäntti J.
C. elegans dss-1 is functionally conserved and required for oogenesis and larval growth.
BMC Dev Biol 2008 8 51 
[ PubMed ID = 18471277 ] [ RRC reference ]

Youds JL, Barber LJ, Ward JD, Collis SJ, O'Neil NJ, Boulton SJ, Rose AM.
DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair.
Mol Cell Biol 2008 28(5) 1470-9 
[ PubMed ID = 18086896 ] [ RRC reference ]

Goodyer W, Kaitna S, Couteau F, Ward JD, Boulton SJ, Zetka M.
HTP-3 links DSB formation with homolog pairing and crossing over during C. elegans meiosis.
Dev Cell 2008 14(2) 263-74 
[ PubMed ID = 18267094 ] [ RRC reference ]

Ward JD, Barber LJ, Petalcorin MI, Yanowitz J, Boulton SJ.
Replication blocking lesions present a unique substrate for homologous recombination.
EMBO J 2007 26(14) 3384-96 
[ PubMed ID = 17611606 ] [ RRC reference ]

Petalcorin MI, Galkin VE, Yu X, Egelman EH, Boulton SJ.
Stabilization of RAD-51-DNA filaments via an interaction domain in Caenorhabditis elegans BRCA2.
Proc Natl Acad Sci U S A 2007 104(20) 8299-304 
[ PubMed ID = 17483448 ] [ RRC reference ]

Martin JS, Winkelmann N, Petalcorin MI, McIlwraith MJ, Boulton SJ.
RAD-51-dependent and -independent roles of a Caenorhabditis elegans BRCA2-related protein during DNA double-strand break repair.
Mol Cell Biol 2005 25(8) 3127-39 
[ PubMed ID = 15798199 ] [ RRC reference ]