Mutants (Isolated)

tm1084

Allele Nametm1084
Sequence NameW03D2.5a
CGC Namewrt-5
Worm BaseAllele Name tm1084
CGC Name wrt-5
Sequence W03D2.5a
Phenotypehomozygous viable. Dr. T. Burglin: Dev. Biol. 290, 323-336 (2006).
Mutation site2346/2347-2717/2718 (371 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(2086..2191, 2238..2347 ,2414..2560, 3344..3511))
Map position-0.92
Balancer
Map position of balancer
Sequence of primersIntRev:CCAGAAGGTCATAGGATGAT,ExtRev:GAAAGATCCGAGAGATCCCA,ExtFwd:GCAACCAATCGCTTAGCAAC,IntFwd:GCAACCCGAAAACACCCGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hao L, Aspöck G, Bürglin TR.
The hedgehog-related gene wrt-5 is essential for hypodermal development in Caenorhabditis elegans.
Dev. Biol. 2006 290(2) 323-36 
[ PubMed ID = 16413526 ] [ RRC reference ]