Mutants (Isolated)

tm1079

Allele Nametm1079
Sequence NameY73B6BL.7
CGC Namecsp-2
Worm BaseAllele Name tm1079
CGC Name csp-2
Sequence Y73B6BL.7
Phenotypehomozygous viable. Dr. R.H. Horvitz: No extra cells in anterior pharynx. Dr. S. Shaham: no defects in somatic cell death.
Mutation site24165/24166-ATCA-24843/24844 (678 bp deletion + 4 bp insertion)
ChromosomeIV
Putative gene structurejoin(21611..21668, 21717..21761, 23028..23173, 23521..23670, 23772..23958, 24486..25184, 25323..25400, 25454..25522, 25838..25948, 26210..26320, 28295..28545, 28591..28792, 28840..28934, 28979..29215, 29258..29299)
Map position3.15
Balancer
Map position of balancer
Sequence of primersIntRev:TATTGGGCGATTGAAGCCGT,ExtRev:CTCGCATATCGGATTCGATC,ExtFwd:CGGCAGTCTCGGTTGCGATT,IntFwd:AGAGGTTCGGGAGCCGGTAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Abraham MC, Lu Y, Shaham S.
A morphologically conserved nonapoptotic program promotes linker cell death in Caenorhabditis elegans.
Dev. Cell 2007 12(1) 73-86 
[ PubMed ID = 17199042 ] [ RRC reference ]