Mutants (Isolated)

tm1075

Allele Nametm1075
Sequence NameF28H6.1a
CGC Nameakt-2
Worm BaseAllele Name tm1075
CGC Name akt-2
Sequence F28H6.1a
Phenotypehomozygous viable. Dr. W.B. Derry: Current Biol. 17, 286 (2007).
Mutation site36891/36892-37473/37474 (582 bp deletion)
ChromosomeX
Putative gene structurejoin(35289..35383, 35587..35695, 36588..36788, 36832..36951, 37176..37373, 37845..37975, Z92837:104..164, Z92837:275..403, Z92837:451..813, Z92837:1091..1270)
Map position16.55
Balancer
Map position of balancer
Sequence of primersExtFwd:TTATGCGGATAGCGCCGACT,IntFwd:GTCAGATGTGGATTGAAGCA,ExtRev:CTGTCGGAAGTTCTTCCCCT,IntRev:TCTACGTGGAGGCGTCAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nakagawa A, Sullivan KD, Xue D.
Caspase-activated phosphoinositide binding by CNT-1 promotes apoptosis by inhibiting the AKT pathway.
Nat. Struct. Mol. Biol. 2014 21(12) 1082-90 
[ PubMed ID = 25383666 ] [ RRC reference ]

Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ. 2012 19(8) 1398-407 
[ PubMed ID = 22388351 ] [ RRC reference ]

Quevedo C, Kaplan DR, Derry WB.
AKT-1 regulates DNA-damage-induced germline apoptosis in C. elegans.
Curr. Biol. 2007 17(3) 286-92 
[ PubMed ID = 17276923 ] [ RRC reference ]