Mutants (Isolated)

tm1061

Allele Nametm1061
Sequence NameF59E11.8
CGC Namenhr-194
Worm BaseAllele Name tm1061
CGC Name nhr-194
Sequence F59E11.8
Phenotypehomozygous viable
Mutation site1475/1476-1871/1872 (396 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(36..143, 193..558, 605..700, 752..970, 1021..1107, 1227..1253))
Map position1.89
Balancer
Map position of balancer
Sequence of primersIntRev:TTTACTCCTGTCTGCTCTCT,ExtFwd:AATGAGACCACTTGACGCGA,ExtRev:CAAGTGGTCTCATCCGGATA,IntFwd:CGCTCCGAAAACGTCCCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Johnson RP, Kramer JM.
Neural maintenance roles for the matrix receptor dystroglycan and the nuclear anchorage complex in Caenorhabditis elegans.
Genetics 2012 190(4) 1365-77 
[ PubMed ID = 22298703 ] [ RRC reference ]