Home > Mutants (Isolated) > tm10601

Mutants (Isolated)

Allele Name		tm10601
Allele Type		OutCrossed
Sequence Name		ZK1053.3
Gene Name		ZK1053.3
Worm Base	Allele Name	tm10601 (x1)
	Gene Name	ZK1053.3
	Sequence	ZK1053.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		21633/21634-GATCATACTTCGAACG-21730/21731 (97 bp deletion + 16 bp insertion)
Chromosome		I
Putative gene structure		join(19153..19491, 19537..19755, 19803..20168, 20467..20629, 20681..21298, 21344..21981)
Map position		17.32
Balancer
Map position of balancer
Sequence of primers		ExtRev:CTACATGGCGCAGTAGACAA,ExtFwd:CAATCTCAACCCGCTTGGCC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Min H, Lee YU, Shim YH, Kawasaki I. Autophagy of germ-granule components, PGL-1 and PGL-3, contributes to DNA damage-induced germ cell apoptosis in C. elegans. PLoS Genet 2019 15(5) e1008150  [ PubMed ID = 31125345 ] [ RRC reference ]