Mutants (Isolated)

tm1060

Allele Nametm1060
Sequence NameF58G6.1
CGC Nameamph-1
Worm BaseAllele Name tm1060
CGC Name amph-1
Sequence F58G6.1
Phenotypehomozygous viable. Dr. A. Fraser: synthetic embryonic lethal with T06G6.9 (RNAi), F21C3.5 (RNAi) and R151.9 (RNAi). D. Z. Zhou: no engulfment defect in embryos and hermaphrodite gonad. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium.
Mutation site7601/7602-8049/8050 (448 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(4939..5253, 5597..5662, 5746..5844, 6129..6221, 6271..6426, 6808..6906, 6955..7041, 7198..7278, 7327..7428, 7476..7592, 7728..7841, 7887..7943))
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntFwd:CGAGCAACTCTCAAATAGTC,ExtFwd:GAGTGAGAGCTCGGGCTTCA,ExtRev:GTTCCAGCTGAGAGGGCGTT,IntRev:TAATCGCTTACTCTCGGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pant S, Sharma M, Patel K, Caplan S, Carr CM, Grant BD.
AMPH-1/Amphiphysin/Bin1 functions with RME-1/Ehd1 in endocytic recycling.
Nat. Cell Biol. 2009 11(12) 1399-410 
[ PubMed ID = 19915558 ] [ RRC reference ]

D'Alessandro M, Hnia K, Gache V, Koch C, Gavriilidis C, Rodriguez D, Nicot AS, Romero NB, Schwab Y, Gomes E, Labouesse M, Laporte J.
Amphiphysin 2 Orchestrates Nucleus Positioning and Shape by Linking the Nuclear Envelope to the Actin and Microtubule Cytoskeleton.
Dev. Cell 2015 35(2) 186-98 
[ PubMed ID = 26506308 ] [ RRC reference ]

Liu O, Grant BD.
Basolateral Endocytic Recycling Requires RAB-10 and AMPH-1 Mediated Recruitment of RAB-5 GAP TBC-2 to Endosomes.
PLoS Genet. 2015 11(9) e1005514 
[ PubMed ID = 26393361 ] [ RRC reference ]