Mutants (Isolated)

tm1060

Allele Nametm1060
Sequence NameF58G6.1
CGC Nameamph-1
Worm BaseAllele Name tm1060
CGC Name amph-1
Sequence F58G6.1
Phenotypehomozygous viable. Dr. A. Fraser: synthetic embryonic lethal with T06G6.9 (RNAi), F21C3.5 (RNAi) and R151.9 (RNAi). D. Z. Zhou: no engulfment defect in embryos and hermaphrodite gonad. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium.
Mutation site7601/7602-8049/8050 (448 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(4939..5253, 5597..5662, 5746..5844, 6129..6221, 6271..6426, 6808..6906, 6955..7041, 7198..7278, 7327..7428, 7476..7592, 7728..7841, 7887..7943))
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntFwd:CGAGCAACTCTCAAATAGTC,ExtFwd:GAGTGAGAGCTCGGGCTTCA,ExtRev:GTTCCAGCTGAGAGGGCGTT,IntRev:TAATCGCTTACTCTCGGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
D'Alessandro M, Hnia K, Gache V, Koch C, Gavriilidis C, Rodriguez D, Nicot AS, Romero NB, Schwab Y, Gomes E, Labouesse M, Laporte J.
Amphiphysin 2 Orchestrates Nucleus Positioning and Shape by Linking the Nuclear Envelope to the Actin and Microtubule Cytoskeleton.
Dev Cell 2015 35(2) 186-98 
[ PubMed ID = 26506308 ] [ RRC reference ]

Liu O, Grant BD.
Basolateral Endocytic Recycling Requires RAB-10 and AMPH-1 Mediated Recruitment of RAB-5 GAP TBC-2 to Endosomes.
PLoS Genet 2015 11(9) e1005514 
[ PubMed ID = 26393361 ] [ RRC reference ]

Pant S, Sharma M, Patel K, Caplan S, Carr CM, Grant BD.
AMPH-1/Amphiphysin/Bin1 functions with RME-1/Ehd1 in endocytic recycling.
Nat Cell Biol 2009 11(12) 1399-410 
[ PubMed ID = 19915558 ] [ RRC reference ]