Mutants (Isolated)

tm1053

Allele Name

tm1053

Sequence Name

C17C3.4

CGC Name

ins-11

Worm Base

Allele Name

tm1053

CGC Name

ins-11

Sequence

C17C3.4

Phenotype

homozygous viable. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. K. Ashrafi: normal Nile Red staining. Dr. J. Kaplan: normal nile red staining. Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin.

Mutation site

26387/26388-26728/26729 (341 bp deletion)

Chromosome

Putative gene structure

join(26652..26817, 26870..26979)

Map position

-1.15

Balancer

Map position of balancer

Sequence of primers

IntFwd:ACACATCATGGCACTTCGAA,ExtFwd:CGTACGGGGGCATTTTTAGA,ExtRev:GCGCATGGAGAGCCAATATT,IntRev:AGGCGGGGAAGAGACGCAAA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Kawano T, Nagatomo R, Kimura Y, Gengyo-Ando K, Mitani S.
Disruption of ins-11, a Caenorhabditis elegans insulin-like gene, and phenotypic analyses of the gene-disrupted animal.
Biosci. Biotechnol. Biochem. 2006 70(12) 3084-7
[ PubMed ID = 17151440 ] [ RRC reference ]

Maures TJ, Booth LN, Benayoun BA, Izrayelit Y, Schroeder FC, Brunet A.
Males shorten the life span of C. elegans hermaphrodites via secreted compounds.
Science 2014 343(6170) 541-4
[ PubMed ID = 24292626 ] [ RRC reference ]

Evans EA, Kawli T, Tan MW.
Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans.
PLoS Pathog. 2008 4(10) e1000175
[ PubMed ID = 18927620 ] [ RRC reference ]

Ludewig AH, Gimond C, Judkins JC, Thornton S, Pulido DC, Micikas RJ, Döring F, Antebi A, Braendle C, Schroeder FC.
Larval crowding accelerates C. elegans development and reduces lifespan.
PLoS Genet. 2017 13(4) e1006717
[ PubMed ID = 28394895 ] [ RRC reference ]

Lee K, Mylonakis E.
An Intestine-Derived Neuropeptide Controls Avoidance Behavior in Caenorhabditis elegans.
Cell Rep 2017 20(10) 2501-2512
[ PubMed ID = 28877481 ] [ RRC reference ]

Lee SH, Omi S, Thakur N, Taffoni C, Belougne J, Engelmann I, Ewbank JJ, Pujol N.
Modulatory upregulation of an insulin peptide gene by different pathogens in C. elegans.
Virulence 2018 9(1) 648-658
[ PubMed ID = 29405821 ] [ RRC reference ]

Labocha MK, Yuan W, Aleman-Meza B, Zhong W.
A strategy to apply quantitative epistasis analysis on developmental traits.
BMC Genet. 2017 18(1) 42
[ PubMed ID = 28506208 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat. Cell Biol. 2017 19(3) 252-257
[ PubMed ID = 28166192 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472
[ PubMed ID = 23658528 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J. 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]