Mutants (Isolated)

tm1036

Allele Nametm1036
Sequence NameF43G9.11
CGC Nameces-1
Worm BaseAllele Name tm1036
CGC Name ces-1
Sequence F43G9.11
Phenotypehomozygous viable
Mutation site28962/28963-30248/30249 (1286 bp deletion)
ChromosomeI
Putative gene structurejoin(28790..28865, 29181..29484, 29536..29617, 29718..29797, 30561..30745, 30800..30885)
Map position3.01
Balancer
Map position of balancer
Sequence of primersIntRev:CTGGTTGCTAGTTTCACTAC,ExtRev:GTGAACACTTAGCCCCAGCT,ExtFwd:TGTCCCATCTGCCTGCATGA,IntFwd:ATTGAGCGAGCTTAAACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wei H, Yan B, Gagneur J, Conradt B.
Caenorhabditis elegans CES-1 Snail Represses pig-1 MELK Expression To Control Asymmetric Cell Division.
Genetics 2017 206(4) 2069-2084 
[ PubMed ID = 28652378 ] [ RRC reference ]

Yan B, Memar N, Gallinger J, Conradt B.
Coordination of cell proliferation and cell fate determination by CES-1 snail.
PLoS Genet 2013 9(10) e1003884 
[ PubMed ID = 24204299 ] [ RRC reference ]

Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z, Feng D, Chen S, Zhang H.
O-GlcNAc-modification of SNAP-29 regulates autophagosome maturation.
Nat Cell Biol 2014 16(12) 1215-26 
[ PubMed ID = 25419848 ] [ RRC reference ]