Mutants (Isolated)

tm1034

Allele Nametm1034
Sequence NameY49E10.11
CGC Nametat-1
Worm BaseAllele Name tm1034
CGC Name tat-1
Sequence Y49E10.11
Phenotypehomozygous viable. Dr. M. Han: normal growth rate. Dr. S. Tuck: Traffick 10, 88 (2009).
Mutation site47578/47579-A-48175/48176 (597 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(31959..32056, 32642..32766, 37381..37473, 38318..38574, 39898..40038, 40248..40381, 40524..40678, 42286..42815, 44720..45258, 46349..46649, 47456..47568, 48159..48398, 50066..50372, 51442..51627, 52670..52769, 52820..52877, 53218..53260))
Map position17.57
Balancer
Map position of balancer
Sequence of primersExtFwd:CCAGTATGACAAACAGCCAT,IntFwd:CACATTCCGTGTAAGAGTGC,ExtRev:CTACACTGGACACGACTCAA,IntRev:ACGACTCAAAGCTGCTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ruaud AF, Nilsson L, Richard F, Larsen MK, Bessereau JL, Tuck S.
The C. elegans P4-ATPase TAT-1 regulates lysosome biogenesis and endocytosis.
Traffic 2009 10(1) 88-100 
[ PubMed ID = 18939953 ] [ RRC reference ]

Denning DP, Hatch V, Horvitz HR.
Both the caspase CSP-1 and a caspase-independent pathway promote programmed cell death in parallel to the canonical pathway for apoptosis in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003341 
[ PubMed ID = 23505386 ] [ RRC reference ]

Wang X, Li W, Zhao D, Liu B, Shi Y, Chen B, Yang H, Guo P, Geng X, Shang Z, Peden E, Kage-Nakadai E, Mitani S, Xue D.
Caenorhabditis elegans transthyretin-like protein TTR-52 mediates recognition of apoptotic cells by the CED-1 phagocyte receptor.
Nat. Cell Biol. 2010 12(7) 655-64 
[ PubMed ID = 20526330 ] [ RRC reference ]

Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, Xue D.
Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry.
Science 2008 320(5875) 528-31 
[ PubMed ID = 18436785 ] [ RRC reference ]

Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ. 2012 19(8) 1398-407 
[ PubMed ID = 22388351 ] [ RRC reference ]

Seamen E, Blanchette JM, Han M.
P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans.
PLoS Genet. 2009 5(8) e1000589 
[ PubMed ID = 19662161 ] [ RRC reference ]