Mutants (Isolated)

tm1033

Allele Nametm1033
Sequence NameK08A2.5
CGC Namenhr-88
Worm BaseAllele Name tm1033
CGC Name nhr-88
Sequence K08A2.5
Phenotypehomozygous viable. Dr. K. Ashrafi: moderately increased fat (nile red staining).
Mutation site15470/15471-16239/16240 (769 bp deletion)
ChromosomeII
Putative gene structurejoin(14913..14977, 15393..15490, 16063..16517, 19691..19968, 20305..20500, 21012..21092, 21761..21865, 21911..22414)
Map position-9.07
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCGTGGTTGTCTTAGGCCT,IntFwd:CCTCCCCCTCATATCCGTCA,ExtRev:TTACCTAGGAGCAGCCGACA,IntRev:TCCCGCAAGTCGCCTGATCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]