Home > Mutants (Isolated) > tm10270

Mutants (Isolated)

Allele Name		tm10270
Allele Type		Normal
Sequence Name		F53B7.5
Gene Name		fig-1
Worm Base	Allele Name	tm10270
	Gene Name	fig-1
	Sequence	F53B7.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		1461/1462-A-1541/1542 (80 bp deletion + 1 bp insertion)
Chromosome		V
Putative gene structure		complement(join(Z72507.1:36224..36344, Z72507.1:36517..36668, 39..602, 672..868, 916..1105, 1149..2740, 2832..3318, 3371..3507, 3561..4107, 4160..4725, 4770..5060, 5139..5528, 5574..5915, 5960..6701, 6754..7092, 7153..7289, 7332..8823))
Map position		2.88
Balancer
Map position of balancer
Sequence of primers		IntRev:TCTGCATCTCAGTGGGTTGT,ExtRev:GCGACTTCATCAACTGGAAC,IntFwd:TTGATCGACTGCATGCCAAC,ExtFwd:CCTTCGATGAGAGGATTGAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Valperga G, de Bono M. Impairing one sensory modality enhances another by reconfiguring peptidergic signalling in Caenorhabditis elegans. Elife 2022 11   [ PubMed ID = 35201977 ] [ RRC reference ]