Mutants (Isolated)

tm1027

Allele Nametm1027
Sequence NameT06C12.10
CGC Namecgt-1
Worm BaseAllele Name tm1027
CGC Name cgt-1
Sequence T06C12.10
Phenotypehomozygous viable
Mutation site21344/21345-22280/22281 (936 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(20129..20178, 20276..20438, 20735..21058, 21213..21433, 21480..21715, 21774..22005, 22058..22100))
Map position9.1
Balancer
Map position of balancer
Sequence of primersExtFwd:CCCATTCCTAAAAACACTGC,IntRev:GATATTTCGTGCAGAAGCTC,ExtRev:ACAACTTCCTTCAGTCAGAG,IntFwd:GGATGTTTCCAAACTTTCGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boland S, Schmidt U, Zagoriy V, Sampaio JL, Fritsche RF, Czerwonka R, Lübken T, Reimann J, Penkov S, Knölker HJ, Kurzchalia TV.
Phosphorylated glycosphingolipids essential for cholesterol mobilization in Caenorhabditis elegans.
Nat Chem Biol 2017 13(6) 647-654 
[ PubMed ID = 28369040 ] [ RRC reference ]

Zhu H, Shen H, Sewell AK, Kniazeva M, Han M.
A novel sphingolipid-TORC1 pathway critically promotes postembryonic development in Caenorhabditis elegans.
Elife 2013 2 e00429 
[ PubMed ID = 23705068 ] [ RRC reference ]

Nomura KH, Murata D, Hayashi Y, Dejima K, Mizuguchi S, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Hirabayashi Y, Ito M, Nomura K.
Ceramide glucosyltransferase of the nematode Caenorhabditis elegans is involved in oocyte formation and in early embryonic cell division.
Glycobiology 2011 21(6) 834-48 
[ PubMed ID = 21325339 ] [ RRC reference ]

Kniazeva M, Zhu H, Sewell AK, Han M.
A Lipid-TORC1 Pathway Promotes Neuronal Development and Foraging Behavior under Both Fed and Fasted Conditions in C. elegans.
Dev Cell 2015 33(3) 260-71 
[ PubMed ID = 25892013 ] [ RRC reference ]

Cui M, Wang Y, Cavaleri J, Kelson T, Teng Y, Han M.
Starvation-Induced Stress Response Is Critically Impacted by Ceramide Levels in Caenorhabditis elegans.
Genetics 2017 205(2) 775-785 
[ PubMed ID = 27974500 ] [ RRC reference ]

Marza E, Simonsen KT, Faergeman NJ, Lesa GM.
Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells.
J Cell Sci 2009 122(Pt 6) 822-33 
[ PubMed ID = 19240113 ] [ RRC reference ]