Mutants (Isolated)

tm1022

Allele Nametm1022
Sequence NameB0280.8
CGC Namenhr-10
Worm BaseAllele Name tm1022
CGC Name nhr-10
Sequence B0280.8
Phenotypehomozygous viable. Dr. K. Ashrafi: wild type fat (nile red staining). Dr. A. Walhout: deletion is in the 3rd intron.
Mutation site11837/11838-12266/12267 (429 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(10615..10759, 10815..11185, 11541..11678, 11724..11897, 12381..12547, 12593..12672, 13288..13400))
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTTCAGGTGTTCTGTCAAA,IntRev:GTATGCTTGGTTTGTTCCGA,ExtRev:AACTCGTCTCAACCTGAAGA,ExtFwd:ATCCAAGAGGACGAGTTGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Arda HE, Taubert S, MacNeil LT, Conine CC, Tsuda B, Van Gilst M, Sequerra R, Doucette-Stamm L, Yamamoto KR, Walhout AJ.
Functional modularity of nuclear hormone receptors in a Caenorhabditis elegans metabolic gene regulatory network.
Mol. Syst. Biol. 2010 6 367 
[ PubMed ID = 20461074 ] [ RRC reference ]