Mutants (Isolated)

tm1021

Allele Name

tm1021

Allele Type

Normal

Sequence Name

K10D2.3

Gene Name

cid-1

Worm Base

Allele Name

tm1021

Gene Name

cid-1

Sequence

K10D2.3

Phenotype

homozygous viable. Dr. R. Plasterk: Genes & Dev. 19, 782- (2005).

Mutation site

7321/7322-GGAAATCTT-7965/7966 (644 bp deletion + 9 bp insertion)

Chromosome

III

Putative gene structure

join(6864..6945, 7243..7700, 7821..7983, 8034..8341, 8504..9496, 9546..10079, 10162..11018, 11531..11639, 11689..12100, 12432..12642, 12688..12808, 12896..12925)

Map position

-2.04

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TCTGCGTCACTTGCAAGACA,IntFwd:GTGTGGCTATTCTGACTCGT,ExtRev:TCCGGAAGTGTGACGTCATA,IntRev:GCAATCCAATCGATGGGAAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Vieux KF, Prothro KP, Kelley LH, Palmer C, Maine EM, Veksler-Lublinsky I, McJunkin K.
Screening by deep sequencing reveals mediators of microRNA tailing in C. elegans.
Nucleic Acids Res 2021 49(19) 11167-11180
[ PubMed ID = 34586415 ] [ RRC reference ]

Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115
[ PubMed ID = 32887607 ] [ RRC reference ]

Li Y, Maine EM.
The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans.
Development 2018 145(19)
[ PubMed ID = 30305273 ] [ RRC reference ]

Xu F, Feng X, Chen X, Weng C, Yan Q, Xu T, Hong M, Guang S.
A Cytoplasmic Argonaute Protein Promotes the Inheritance of RNAi.
Cell Rep 2018 23(8) 2482-2494
[ PubMed ID = 29791857 ] [ RRC reference ]

Le Pen J, Jiang H, Di Domenico T, Kneuss E, Kosałka J, Leung C, Morgan M, Much C, Rudolph KLM, Enright AJ, O'Carroll D, Wang D, Miska EA.
Terminal uridylyltransferases target RNA viruses as part of the innate immune system.
Nat Struct Mol Biol 2018 25(9) 778-786
[ PubMed ID = 30104661 ] [ RRC reference ]

Shakes DC, Allen AK, Albert KM, Golden A.
emb-1 encodes the APC16 subunit of the Caenorhabditis elegans anaphase-promoting complex.
Genetics 2011 189(2) 549-60
[ PubMed ID = 21775471 ] [ RRC reference ]

de Albuquerque BF, Placentino M, Ketting RF.
Maternal piRNAs Are Essential for Germline Development following De Novo Establishment of Endo-siRNAs in Caenorhabditis elegans.
Dev Cell 2015 34(4) 448-56
[ PubMed ID = 26279485 ] [ RRC reference ]

van Wolfswinkel JC, Claycomb JM, Batista PJ, Mello CC, Berezikov E, Ketting RF.
CDE-1 affects chromosome segregation through uridylation of CSR-1-bound siRNAs.
Cell 2009 139(1) 135-48
[ PubMed ID = 19804759 ] [ RRC reference ]

Robert VJ, Sijen T, van Wolfswinkel J, Plasterk RH.
Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences.
Genes Dev 2005 19(7) 782-7
[ PubMed ID = 15774721 ] [ RRC reference ]