Mutants (Isolated)

tm1010

Allele Nametm1010
Sequence NameF21D12.3
CGC NameF21D12.3
Worm BaseAllele Name tm1010
CGC Name F21D12.3
Sequence F21D12.3
Phenotypehomozygous viable
Mutation site5466/5467-CG-6905/6906 (1439 bp deletion + 2 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(5161..5353, 5403..5514, 5568..5772, 5821..6169, 6231..6295, 6342..6471, 6520..6799, 7259..7442))
Map position0.5
Balancer
Map position of balancer
Sequence of primersIntRev:GGCCGATCCATACATCAATA,IntFwd:TCCACCAAGAATGGCTCCGA,ExtRev:AGTCTGCTTTCTAGCGGGCA,ExtFwd:CTTGATATGATCCGAGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hostettler L, Grundy L, Käser-Pébernard S, Wicky C, Schafer WR, Glauser DA.
The Bright Fluorescent Protein mNeonGreen Facilitates Protein Expression Analysis In Vivo.
G3 (Bethesda) 2017 7(2) 607-615 
[ PubMed ID = 28108553 ] [ RRC reference ]