Gene Disrupted Strains - Detail

Strain No MGNA-C496
Constructor TUAT-2
Genotype yqeV
Original Name YQEVd
BG BG11646
Gene (Subtiwiki) yqeV
Locus Tag BSU25430
Product
Product (Old Name) methylation of Isopentenylated A37 derivatives in tRNA
BSORF yqeV
Length 451
Mutant YQEVd
Forward Length 20
Forward Primer TGCGATTTCTTATCAAACAG
Reverse Length 20
Reverse Primer GAGCAGTTATCACCTGATCC
Inspection PCR Product
The First Inspection Length-1 (bp) 400
Length-2 (bp) 1700
The Second Inspection Length-3 (bp)
Other Remarks
Reference Anton BP, Russell SP, Vertrees J, Kasif S, Raleigh EA, Limbach PA, Roberts RJ.
Functional characterization of the YmcB and YqeV tRNA methylthiotransferases of Bacillus subtilis.
Nucleic Acids Res.  (2010)  38(18)   6195-205  
[PubMed ID = 20472640]  [RRC reference
Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc. Natl. Acad. Sci. U.S.A.  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference
Request
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}