Gene Disrupted Strains - Detail

Strain No MGNA-A007
Constructor SCHUMANN
Genotype yrrO
Original Name BFS2069
BG BG13796
Gene (Subtiwiki) yrrO
Locus Tag BSU27340
Product putative hydrolase
Product (Old Name) similar to protease
BSORF yrrO
Length 422
Mutant BFS2069
Forward Length 20
Forward Primer AACCGTGACGAATACGAAGC
Reverse Length 21
Reverse Primer AAACTGTTCATAAATGGACCG
Inspection PCR Product
The First Inspection Length-1 (bp) 800
Length-2 (bp) Not amplified
The Second Inspection Length-3 (bp)
Other Remarks
Reference Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc Natl Acad Sci U S A  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference
Request
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","enableGmoPgMultiPayment":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}