Gene Disrupted Strains - Detail

Strain No MGNA-C103
Constructor NARA-2
Genotype ydcB
Original Name YDCBp
BG BG12089
Gene (Subtiwiki) acpS
Locus Tag BSU04620
Product holo-acyl carrier protein synthase
Product (Old Name) holo-[acyl-carrier protein] synthase
BSORF acpS
Length 121
Mutant YDCBp
Forward Length 21
Forward Primer GACGGTATCCCTCCATAACAC
Reverse Length 20
Reverse Primer TAACGGTACGCTCGGTACAC
Inspection PCR Product
The First Inspection Length-1 (bp) Not amplified
Length-2 (bp) 2600
The Second Inspection Length-3 (bp) 800
Other Remarks
Genome Map
Reference Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc Natl Acad Sci U S A  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference] 
Related Pathways
Updated:2023/08/29		 bsu00770 Pantothenate and CoA biosynthesis
bsu01100 Metabolic pathways
Request Not available
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","enableGmoPgMultiPayment":"true","enableGmoPgMultiPaymentLinkTypePlus":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}