Inspection	PCR Product
Strain No		MGNA-A098
Constructor		EHRLICH
Genotype		dacB
Original Name		BFS10
BG		BG10527
Gene (Subtiwiki)		dacB
Locus Tag		BSU23190
Product		D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5*)
Product (Old Name)		penicillin-binding protein 5* (D-alanyl-D-alanine carboxypeptidase)
BSORF		dacB
Length		382
Mutant
Forward Length		20
Forward Primer		CATAACTGATGGACATGCGC
Reverse Length		20
Reverse Primer		CGATCACGGTTAAACTGACC
The First Inspection	Length-1 (bp)	500
The First Inspection	Length-2 (bp)	1200
The Second Inspection	Length-3 (bp)	1200,About 10kb
Other Remarks
Genome Map
Reference		Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N. Essential Bacillus subtilis genes. Proc Natl Acad Sci U S A (2003) 100(8) 4678-83 [PubMed ID = 12682299] [RRC reference]
Related Pathways Updated:2023/08/29		bsu00550 Peptidoglycan biosynthesis bsu01100 Metabolic pathways
Request

Shopping Cart

Error

Gene Disrupted Strains - Detail