Gene Disrupted Strains - Detail

Strain No MGNA-C066
Constructor Tsukuba2
Genotype yclO
Original Name YCLOd
BG BG12035
Gene (Subtiwiki) yclO
Locus Tag BSU03810
Product transporter for petrobactin (PB), a photoreactive 3,4-catecholate siderophore, permease protein, Fur regulon
Product (Old Name) probable ferrichrome transport system permease protein
BSORF yclO
Length 315
Mutant YCLOd
Forward Length 21
Forward Primer ATACTGGGCAGAATCATTATC
Reverse Length 21
Reverse Primer TTAGGACCGATAAACGAGGTG
Inspection PCR Product
The First Inspection Length-1 (bp) 450
Length-2 (bp) 1100
The Second Inspection Length-3 (bp)
Other Remarks
Reference Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc. Natl. Acad. Sci. U.S.A.  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference
Request
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","enableGmoPgMultiPayment":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}