Gene Disrupted Strains - Detail

Strain No MGNA-B879
Constructor NAIST-2
Genotype yaaA
Original Name YAAAd
BG BG10067
Gene (Subtiwiki) yaaA
Locus Tag BSU00030
Product putative RNA binding protein
Product (Old Name) conserved protein
BSORF yaaA
Length 71
Mutant YAAAd
Forward Length 22
Forward Primer TTTCTATTCGGTATCTGCTCCG
Reverse Length 21
Reverse Primer GTTCAGCATGGTCGTAGTTGC
Inspection PCR Product
The First Inspection Length-1 (bp) 100
Length-2 (bp) Not amplified
The Second Inspection Length-3 (bp)
Other Remarks
Reference Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc. Natl. Acad. Sci. U.S.A.  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference
Request
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","enableGmoPgMultiPayment":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}