Gene Disrupted Strains - Detail

Strain No MGNA-B754
Constructor fubt-2
Genotype yxlH
Original Name YXLHd
BG BG12554
Gene (Subtiwiki) yxlH
Locus Tag BSU38640
Product putative efflux transporter
Product (Old Name) similar to multidrug-efflux transporter
BSORF yxlH
Length 400
Mutant YXLHd
Forward Length 20
Forward Primer TCCGTCTGATCCGTATTAAC
Reverse Length 21
Reverse Primer CCTTTGCTGTTCACTATTTCC
Inspection PCR Product
The First Inspection Length-1 (bp) 500
Length-2 (bp) 1400
The Second Inspection Length-3 (bp)
Other Remarks
Reference Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, Boland F, Brignell SC, Bron S, Bunai K, Chapuis J, Christiansen LC, Danchin A, Débarbouille M, Dervyn E, Deuerling E, Devine K, Devine SK, Dreesen O, Errington J, Fillinger S, Foster SJ, Fujita Y, Galizzi A, Gardan R, Eschevins C, Fukushima T, Haga K, Harwood CR, Hecker M, Hosoya D, Hullo MF, Kakeshita H, Karamata D, Kasahara Y, Kawamura F, Koga K, Koski P, Kuwana R, Imamura D, Ishimaru M, Ishikawa S, Ishio I, Le Coq D, Masson A, Mauël C, Meima R, Mellado RP, Moir A, Moriya S, Nagakawa E, Nanamiya H, Nakai S, Nygaard P, Ogura M, Ohanan T, O'Reilly M, O'Rourke M, Pragai Z, Pooley HM, Rapoport G, Rawlins JP, Rivas LA, Rivolta C, Sadaie A, Sadaie Y, Sarvas M, Sato T, Saxild HH, Scanlan E, Schumann W, Seegers JF, Sekiguchi J, Sekowska A, Séror SJ, Simon M, Stragier P, Studer R, Takamatsu H, Tanaka T, Takeuchi M, Thomaides HB, Vagner V, van Dijl JM, Watabe K, Wipat A, Yamamoto H, Yamamoto M, Yamamoto Y, Yamane K, Yata K, Yoshida K, Yoshikawa H, Zuber U, Ogasawara N.
Essential Bacillus subtilis genes.
Proc. Natl. Acad. Sci. U.S.A.  (2003)  100(8)   4678-83  
[PubMed ID = 12682299]  [RRC reference
Request
page-top
/bsub
/bsub {"serialVersionUID":"2857842948722439475","enableRequest":"true","enableGmoPgMultiPayment":"true","announcementPathNbrpRelated":"/shigen/www/webapps/announcement/nbrpRelated.properties","announcementPathBsubMaintenance":"/shigen/www/webapps/announcement/bsubMaintenance.properties","contextPath":"/bsub","announcementPathServerMaintenance":"/shigen/www/webapps/announcement/serverMaintenance.properties","lastUpdateDate":"2016/08/04","depth":"3"}