Marker

Marker Detail

Marker
Marker name AUT10282
Map name SSR
Chromosome No. 1
Start (bp):Build5 4,802,644 -->Get Sequence
End (bp):Build5 4,802,782
Direction:Build5 +
Length:Build5 139
Start (bp):Ver1.0 4,803,644 -->Get Sequence
End (bp):Ver1.0 4,803,782
Direction:Ver1.0 +
Length:Ver1.0 139
Primer forward CAGTCGCACTAACTGAACAACACC
Primer reverse CACGGACAGATCAGTTTCTTTCG
Repeat motif (GGAT)6


Chromosome: 1 ,  position: 4,802,644 - 4,802,782 bp

   Now loading


#
#
/rice/oryzabase