Marker

Marker Detail

Marker
Marker name AUT10260
Map name SSR
Chromosome No. 1
Start (bp):Build5 4,394,497 -->Get Sequence
End (bp):Build5 4,394,637
Direction:Build5 +
Length:Build5 141
Start (bp):Ver1.0 4,395,497 -->Get Sequence
End (bp):Ver1.0 4,395,637
Direction:Ver1.0 +
Length:Ver1.0 141
Primer forward AGTTCATCAACGCGAGGGTACG
Primer reverse AGCAGAACACGAGGAGAATGAGC
Repeat motif (CT)31


Chromosome: 1 ,  position: 4,394,497 - 4,394,637 bp

   Now loading


#
#
/rice/oryzabase