Marker

Marker Detail

Marker
Marker name AUT10246
Map name SSR
Chromosome No. 1
Start (bp):Build5 4,216,178 -->Get Sequence
End (bp):Build5 4,216,257
Direction:Build5 +
Length:Build5 80
Start (bp):Ver1.0 4,217,178 -->Get Sequence
End (bp):Ver1.0 4,217,257
Direction:Ver1.0 +
Length:Ver1.0 80
Primer forward AACAGCAAGAACACCACCTCACC
Primer reverse CGTGAGATCGAGAGTGTGAGAGG
Repeat motif (TCC)9


Chromosome: 1 ,  position: 4,216,178 - 4,216,257 bp

   Now loading


#
#
/rice/oryzabase