Marker

Marker Detail

Marker
Marker name AUT10244
Map name SSR
Chromosome No. 1
Start (bp):Build5 4,207,224 -->Get Sequence
End (bp):Build5 4,207,381
Direction:Build5 +
Length:Build5 158
Start (bp):Ver1.0 4,208,224 -->Get Sequence
End (bp):Ver1.0 4,208,381
Direction:Ver1.0 +
Length:Ver1.0 158
Primer forward AGCCCAGAGGGAGTAACTTAACAACC
Primer reverse CACACATCTTGATATGCTGGAAGC
Repeat motif (TG)15


Chromosome: 1 ,  position: 4,207,224 - 4,207,381 bp

   Now loading


#
#
/rice/oryzabase