Marker

Marker Detail

Marker
Marker name AUT10195
Map name SSR
Chromosome No. 1
Start (bp):Build5 3,802,454 -->Get Sequence
End (bp):Build5 3,802,621
Direction:Build5 +
Length:Build5 168
Start (bp):Ver1.0 3,803,454 -->Get Sequence
End (bp):Ver1.0 3,803,621
Direction:Ver1.0 +
Length:Ver1.0 168
Primer forward CACAAACCGAAAGTTGCCCTTCC
Primer reverse TTCGGAGAAGACCGAGACGTAGATGC
Repeat motif (TAA)19


Chromosome: 1 ,  position: 3,802,454 - 3,802,621 bp

   Now loading


#
#
/rice/oryzabase