Marker

Marker Detail

Marker
Marker name AUT10194
Map name SSR
Chromosome No. 1
Start (bp):Build5 3,800,749 -->Get Sequence
End (bp):Build5 3,801,309
Direction:Build5 +
Length:Build5 561
Start (bp):Ver1.0 3,801,749 -->Get Sequence
End (bp):Ver1.0 3,802,309
Direction:Ver1.0 +
Length:Ver1.0 561
Primer forward ATCTTTCTGATGGCACCTTAGC
Primer reverse AGAAAGGTGTTGACTCGAATGC
Repeat motif (CT)20


Chromosome: 1 ,  position: 3,800,749 - 3,801,309 bp

   Now loading


#
#
/rice/oryzabase