Marker

Marker Detail

Marker
Marker name AUT10169
Map name SSR
Chromosome No. 1
Start (bp):Build5 3,483,439 -->Get Sequence
End (bp):Build5 3,483,533
Direction:Build5 +
Length:Build5 95
Start (bp):Ver1.0 3,484,439 -->Get Sequence
End (bp):Ver1.0 3,484,533
Direction:Ver1.0 +
Length:Ver1.0 95
Primer forward GGAGAAGAGATTACCGGAGAGAGC
Primer reverse CTCCTCTCCTTCTCCAGGTTGG
Repeat motif (TCCT)7


Chromosome: 1 ,  position: 3,483,439 - 3,483,533 bp

   Now loading


#
#
/rice/oryzabase