Marker

Marker Detail

Marker
Marker name AUT10164
Map name SSR
Chromosome No. 1
Start (bp):Build5 3,366,250 -->Get Sequence
End (bp):Build5 3,366,530
Direction:Build5 +
Length:Build5 281
Start (bp):Ver1.0 3,367,250 -->Get Sequence
End (bp):Ver1.0 3,367,530
Direction:Ver1.0 +
Length:Ver1.0 281
Primer forward ACCCATCACCATGGCATCAATCC
Primer reverse GATCCCGCGGGTTTCGTAGC
Repeat motif (AG)12


Chromosome: 1 ,  position: 3,366,250 - 3,366,530 bp

   Now loading


#
#
/rice/oryzabase