Marker

Marker Detail

Marker
Marker name AUT10118
Map name SSR
Chromosome No. 1
Start (bp):Build5 2,176,465 -->Get Sequence
End (bp):Build5 2,176,964
Direction:Build5 +
Length:Build5 500
Start (bp):Ver1.0 2,177,465 -->Get Sequence
End (bp):Ver1.0 2,177,964
Direction:Ver1.0 +
Length:Ver1.0 500
Primer forward GTTCCAGCATCATCCATCTGC
Primer reverse GGGCATGTAAGAAATGTGGAAGC
Repeat motif (AG)20


Chromosome: 1 ,  position: 2,176,465 - 2,176,964 bp

   Now loading


#
#
/rice/oryzabase